LAS PRESENTADORAS DE RCN SON PREPAGOS!!!

5 abr

Estoy ya hasta las tetas, repletas de silicona y mentiras de las presentadoras de rcn, porQUe rayos, siguen dando tanta papaya? primero las involucran en ese libro de las prepagos de colombia y ahora las fotos y videos porno de ana karina y laura acuña… eso deja mucho que decir… puden visitar este articulo en esta pagina donde colocan el video porno y es mejor que lo vean ya, porque uno no sabe lo kitan, hasta lo pueden descargar ;) aca el link CLICK AQUI PARA DESCARGAR EL VIDEO

68 comentarios to “LAS PRESENTADORAS DE RCN SON PREPAGOS!!!”

  1. juliana julio 20, 2008 at 2:20 am #

    que cosa tan aterradora con el canal rcn, se fue abajo con tantas prepagos que tiene de presentadoras , esa laura acuña es cosa aparte con ese cachon de gaviria , ya lo tiene tonto de tantos vachos que le pone, fuera esas prepago para que el canal vuelva hacer como antes señores, mandelas para la tierra de ellas

    • maritza octubre 20, 2011 at 8:20 pm #

      deja la envidia ya quisieras tu tener la fama y la belleza de esas mujeres no hables mal de tu genero o acaso te gustaria que se expresaran asi de tu madre o hermanas piensalo y aprende a respectar a las demas

  2. luis agosto 27, 2008 at 6:29 pm #

    si ana karina soto es una perra yo tengo el video d eella en el celular la cara sale clarita

  3. david septiembre 11, 2008 at 3:40 pm #

    no creo en eso me gustaria tener pruebas

  4. JULIETA septiembre 16, 2008 at 8:07 pm #

    NO SE QUE PASA CON ESE CHNDA DE CANAL RCN , CADA VEZ QUE SE LE DICE DE ESAS CLASE DE PRESENTADORAS COMO LAURA ACUÑA Y KARINA SOTTO, ESAS 2 MUJERES LE DAN MALA IMAGEN SAQUELAS DEL CANAL Y METAN TANTA MUJERES QUE HAY EN COLOMBIA CON BELLEZA Y CARISMA Y ADEMAS SANAS

  5. MARIA septiembre 16, 2008 at 8:18 pm #

    señores del canal rcn lastima que era el mejor canal que habia pero empezaron a dañarlo , por que no miran si no caras bonitas.
    por ejemplo ese programa de j mario ya es hueso, no tiene nada llamativo ya a ese señor se le acabo el impulso es hora que lo saquen, menos con esa fastidiosa y petulante de laura acuña.
    depronto vuelve a funcionar que entre de nuevo carolina cruz y yaneth , por que son personas que caen bien .
    y esa ana karina no darle pena salir al publico con semejante video que tiene circulando, mostrandose como dios la trajo al mundo y encima de todo con toda la mazamorra encima. que asco de miujer.
    el pobre de jose gaviria le vamos a mandar un par de limas para que limes los cachos por que ya no puede caminar. como esa bandida de laura sera que no le da abasto gaviria

  6. liset octubre 2, 2008 at 3:24 am #

    son unas solapadas todas

  7. johan jose octubre 14, 2008 at 1:44 am #

    me pareca biwen que las presentadoras de rcn sean prepagos por que estan muy buenas y uno puede haser el asmor con la que uno quiera att johan y luis

  8. pedro jordan diciembre 2, 2008 at 2:43 am #

    so prepagos pero estan muy buenas

  9. ferney diciembre 12, 2008 at 2:58 pm #

    hola quiero ver el video

  10. ferney diciembre 12, 2008 at 2:59 pm #

    ana carina soto

  11. edinson enero 23, 2009 at 4:18 am #

    estoy interesado en conocer el video de ana karina soto, acabo de llegar a colombia y me acabo de enterar de esto.

    no lo puedo creer si nolo veo

    saludos y gracias por enviarmelo

  12. alexys marzo 6, 2009 at 11:34 pm #

    mandenme el video de ana karina soto y las fotos de las famosas prepago de Colombia

  13. jesid abril 4, 2009 at 8:31 pm #

    quiero ver alaura acuña en video o fotos donde se vea que esta haciendo algo malo o proibido

  14. luna abril 11, 2009 at 9:30 pm #

    son lindas

  15. gerardo castañeda abril 21, 2009 at 7:37 pm #

    Hablando de ANA CATALINA TORRES, me parece que es la mujer mas linda de la televisiòn en colombia, y yo personalmente no creo que se a prepago, me parece mas bien que en colombia muere mas gente de envidia que de cancer.
    Ana Catalina, eres divina

  16. gerardo castañeda abril 21, 2009 at 7:39 pm #

    las presentadoras de televisiòn son muy hermosas independientemente de quien sea, sobre ellas recae la envidia y las lenguas viperinas de brujas y tipos resentidos y mal hablados. A todas ellas les digo son divinas

  17. gerardo castañeda abril 21, 2009 at 7:41 pm #

    las mujeres merecen respeto y derecho a una privacidad. Quienes hablan de ellas seguramente no tuvieron madre.
    A todas las mujeres de esta querida colombia, todas son hermosas y merecen nuestra admiraciòn y respeto

  18. el mono abril 23, 2009 at 2:27 am #

    eres muy linda

  19. ZULLY MARIN T. abril 25, 2009 at 12:38 am #

    ME PARECE QUE SI SON PREPAGOS A UNQUE NO LO CREO NO DEBERIAN DE SER TAN SAPOS Y PUBLICARLO EN INTERNET ADEMAS NO DEBEN METERSE EN LA INTIMIDAD DE LAS PERSONAS.

  20. carolina es prosti ana carolina torres andrea serna que por queria

  21. HUGO CHACON mayo 21, 2009 at 4:48 pm #

    laura eres una triple mamita, me sueño haciendo el amor contigo. Estar a tu lado es como tocar el cielo, eres mi fantasìs sexual te amo y sigue cosechando triunfos.

  22. MADELEINE junio 7, 2009 at 10:49 pm #

    TODAS LAS PRESENTADORAS DE RCN SON MUY CHEVERES Y ME GUSTA COMO TRABAJAN EN LA FARANDULA RCN ELN PRIMER LUGAR

  23. vvxcvc junio 15, 2009 at 12:35 am #

    con fotos

  24. petardo junio 18, 2009 at 12:42 am #

    carolina cruz sale con el pulpo de cucuta

  25. petardo junio 18, 2009 at 12:43 am #

    se lo pasan culeando y haciendo orgias en san luis ana karina soto

  26. petardo junio 18, 2009 at 12:43 am #

    me gustaria meterle el toche por esa cuca rica lanbersela a carolina cruz

  27. petardo junio 18, 2009 at 12:44 am #

    la negra candela se lo pasa pichando con jota mario en un motel en bogota

    • lety mayo 29, 2011 at 12:18 am #

      me parese que uno nodeberia meterse en al vida privada pero estoy que me amto de la risa con esos comentarios jajajjaj jota mario con la negra y los cuernos de jose gaviria jajajjajajajja que divertido esto..jajjajaja

  28. candelo junio 18, 2009 at 12:47 am #

    jose gaviria termino con laura acuña disque segun lo tenia desgastado por que cada rato se lo supcionaba

  29. carlos escalante junio 22, 2009 at 11:05 pm #

    son todas perras se dejan ver de muchas camaras

  30. mauricio de jesus posada sanchez junio 24, 2009 at 2:33 pm #

    hola. pues yo diria que todas las presentadoras son hermosas pero no podria decir si son perras o no, lo que si diria es son unas bellas, con un culo hermoso mamasotas todas.

    att. mauricio posada sanchez. de concordia antioquia

  31. side julio 14, 2009 at 2:14 am #

    si son prepago

  32. Jorge septiembre 15, 2009 at 1:13 pm #

    Hola eso es cierto q mamera estar viendo en RCN una manada de prepagos, y quien ve a Carolina Cruz con esa carita de niña buena… pero preguntenle qu era lo que hacia en el Cañon de Garrapatas??

  33. luis fernando septiembre 15, 2009 at 11:41 pm #

    mamacita ven ami

  34. mateo atehortua osorio octubre 13, 2009 at 9:12 pm #

    esa carolina cruz si esta muy bna

  35. martha isabel noviembre 1, 2009 at 1:01 am #

    la verdad sin duda es ella difinitivamente que horror!!!! he visto las fotos mas y un pedasito del video……… estoy mas q segura q es ell…… no le da ni pena mucha PERRA!!!

  36. andres noviembre 13, 2009 at 8:08 pm #

    que buenas que estan esas presentadoras

  37. lina maria borrero noviembre 18, 2009 at 8:10 pm #

    seria verdad que las presentadoras mas famosas de colombia sen prepagos o es que es una fachada y a todas esas perras las sacaron de un burdel

  38. lina maria borrero noviembre 18, 2009 at 8:13 pm #

    sera verdad que las presentdoras mas famosas de colombia osea las del canal rcn sean prepagos o es que a todas esas putas las sacaron de un burdel

  39. lina maria borrero noviembre 18, 2009 at 8:15 pm #

    cuales son las putas que quieren engañar el pais con sus caras de zorras amaestradas

  40. jaime de la pava diciembre 11, 2009 at 3:42 am #

    las presentadoras de rcn son unas putas

  41. no medigan diciembre 13, 2009 at 9:39 pm #

    yo quiero ver esos videos

  42. barbis diciembre 14, 2009 at 9:51 pm #

    mamasitas

  43. lucho enero 26, 2010 at 12:31 am #

    la verdad no lo creia pero eso es lo que dice la mayoria de la gente que putas que son uuuuuuuuaaaaacccccaaaalllllllllllllaaaaaaaaaaaaa

  44. juanfelipe febrero 15, 2010 at 10:14 pm #

    tan perrasssssssssssssssssssssssssssss

  45. juanfelipe febrero 15, 2010 at 10:15 pm #

    son muy cochinas

  46. juanfelipe febrero 15, 2010 at 10:15 pm #

    sobre todo esa laura acuña tan sorra

  47. boris davides febrero 25, 2010 at 8:37 pm #

    yo no creo tantos chismes y cosas malas para destruir la gente y mucho menos a bellas damas como son estas dos personitas que ante todo son la cara amable del pais dejen vivir la gente buena y ellas calleron en algo tambien son humanas y sienten ganas como cualquier ser humano a si es que por favor no las destruyan mas las dos son preciosas y lo que venga de ellas cualquier cosa sera perdonado ellas son lo maximo reciban millones de besitos abrazos

  48. EDWARD marzo 31, 2010 at 5:46 am #

    hola me gustaria tener el video porno de laura acuña y ana karina pero lo que pasa es que el computador es de mi trabajo y esta restringido pero si deja ver los correos cuales quieran que sean, si me los pudieran mandar, muchas gracias-.

  49. paula yaneth abril 6, 2010 at 2:48 pm #

    solo les quiero decir que todas tienen su estilo y son perosnas que merecen tener privacidad y que no se metan en la vida de ellas solo que hablen cosas buenas y las fortalezas que ellas tienen asi como no les gustan que se metan en la vida de ustedes, ah y si son prepagos eso a nadie le importa si les gusta ellas veran pero no es para que se metan en en cerebro de todas chaoooooooo y vivan su vida.

    • paula yaneth abril 12, 2011 at 10:34 pm #

      boba como que no nos importa no ve que se son prepagos les podemos pagar, no sea estupida

  50. carmela diciembre 14, 2010 at 11:54 pm #

    esas viejas son una fufas y aparte laura acuña es una perra prepago comprobada
    porqu

  51. carmela diciembre 14, 2010 at 11:56 pm #

    ella se caso por plata con el presentador de caracol y se en mozo con gaviria
    y ahora lo peorQUE LAURA ACUÑA LA PERRA PREPAGO CONSIGUIO UN JOYERO
    SOLO PIENSA EN PLATICA
    QUE POBREZA Y EN LOS PROGRAMAS CON ESAS BLUSAS

  52. joselito sanchez febrero 23, 2011 at 1:01 am #

    si las presentadoras son prepagos es cosa que a usted no le importa esa es la vida privada de ellas si no las quiere ver cambia de canal o apague la tele respete para que la respeten o es que esta envidiosa porque usted no tiene los cliente que ellas tiene recuerda QUE LA PAJA SE MIRA EN EL OJO AJENO MAS NO LA VIGA EN EL PROPIO NOSEA TAN PURITANA Y DEJA LA DOBLE MORAL SALGA DEL CLOSER Y AGA LO MISMO

  53. joselito sanchez febrero 23, 2011 at 1:13 am #

    que tristesa de la humanidad se preocupan por los demas pero no se preocupan por ellos mismos si les procupa mucho la vida de ellas en vez de atacarlas de esa forma muestreles el camino recto a seguir y dejen la pornografia a un lado que eso no es de gente decente eso es degente sin estudio, sin escrupulos, sin verguenzas que no tiene temor de DIOS tanto los que se prestan para hacer la pornografia como los que la comercialisan y algo mas cruel los que la utilizan para el chantaje como es el caso que amerita mi repudio

  54. wilson marzo 9, 2011 at 2:05 pm #

    bueno en este pais se habla tanta mierda,pero bueno pueda que sea cierto o no, todo mundo tiene derecho a un trabajo y a una privacidad y ha echarse un polvo con quien quiera. lastima que quienes hayan tenido la oportunidad de disfrutar una hermosa dama como esas haya sido tan hp y publicara esos momentos tan especialesado…
    A todas las hermosas y bellas mujeres de este pais y del mundo les aconcejo mirar bien a quien se tiran encima, por que por un ratico de placer las ponen en boca de todo el mundo como si fuera eso un pecado…yo tengo esa dicha y me quedo con ese momento para mi solito.

  55. juan dieho abril 5, 2011 at 11:49 am #

    Cualquiera desearia tener una prepago como estas yo me sueño con Carolina Cruz haciendole el amor esta remamacita

  56. CARLOS abril 23, 2011 at 9:10 pm #

    HOLA ATOLONDRADOS DEL CANAL RCN SAQUEN ESAS VIEJAS DE LAURA ACUÑA Y ANA KARINA DEPRONTO LES PASAN SIDA A USTEDES Y VAN A QUEDAR MAL ANTE LA OPINION PUBLICA.SERA QUE J MARIO SE LO PASA ESA PERRA PUTA DE LAURA ACUÑA Y NO LA SACAN SAQUEN ESAS MODELOS DEL PORNO DE ALLI COLOQUEN MUJERES QUE BALGAN LA PENA.

  57. Gerson mayo 15, 2011 at 11:34 pm #

    …y como cuanto cobraran por una noche de buen sexo, me gustaria comerme a la carolina cruz, para saber por que le hacen tanta bulla.

  58. diego mayo 24, 2011 at 11:04 pm #

    hola que tal como ablan de unas mujeres taaaaaaan ermosas que dios les dio ese don deser tan suprema mete lindas noooooooooo por favor no se amos en vidiosos de jemos que al gun dia tenga dios ese predilegio de conoserlas y conbersar con ellas las admiro en espesial ha jessica cediel

  59. Cesar Cabarcas Avila junio 7, 2011 at 9:10 pm #

    eso es sabido que todas esas viejas son asi de perras y se las dan de santas amigos como hago para ver las imagenes y los videos

  60. mandinga julio 17, 2011 at 12:47 am #

    sus madres pedazos de marikss

  61. camilo agosto 24, 2011 at 8:34 pm #

    buenas tardes quiesiera saber como hago para contratar un servicio de cualquiera de las prepagos de rcn no importa cuanto cobren alguien me podria decir como las contacto adsoluta reserva

  62. ximena octubre 20, 2011 at 9:30 pm #

    pues cada uno con su vida hp sapas y no se metan en lo q no les importan

  63. luis alberto noviembre 5, 2011 at 4:16 am #

    estan muy vuenas

  64. Andres noviembre 7, 2011 at 3:04 pm #

    Esa laurita acuña si una mamasita

  65. cesar noviembre 25, 2011 at 1:44 pm #

    lo unico malo de que sean prepagos es que uno no tiene la plata para pagarles por que quien no quisiera estar en la cama con laura o carolina cruz

Deja un comentario

Introduce tus datos o haz clic en un icono para iniciar sesión:

Logo de WordPress.com

Estás comentando usando tu cuenta de WordPress.com. Cerrar sesión / Cambiar )

Imagen de Twitter

Estás comentando usando tu cuenta de Twitter. Cerrar sesión / Cambiar )

Foto de Facebook

Estás comentando usando tu cuenta de Facebook. Cerrar sesión / Cambiar )

Google+ photo

Estás comentando usando tu cuenta de Google+. Cerrar sesión / Cambiar )

Conectando a %s

Seguir

Recibe cada nueva publicación en tu buzón de correo electrónico.

%d personas les gusta esto: